cDNA Clone CUL3

• Synonyms: CUL-3, PHA2E
• Plasmid: pBABED P U6 CUL3 ex4 KO antisense
• Parent Plasmid: pBABED P U6
• Expressed: CUL3 ex4 KO antisense guide
• Genbank: NM_003590.4
• Species: Human

Sequence of Insert

GTATTTTGTTGTACATACACA

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48909
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR guide plasmid. Targets antisense strand of exon 5, designed to KO CUL3 when co-transfected with antisense guide 48903. Guide sequence shown as sequence of insert. Positives may be enriched for with puromycin prior to further selection by western blotting and FACs. Note this system does not require induction with Tet/Dox. May be used in any cell-line though an empty TRex line is preferable as this allows for downstream rescue and mutant analysis if necessary.