cDNA Clone ASAP1

• Synonyms: AMAP1, CENTB4, DDEF1, PAG2, PAP, ZG14P, KIAA1249
• Plasmid: pBabeD P U6 ASAP1 ex5 KO Sense A
• Parent Plasmid: pBABED P U6
• Expressed: ASAP1 ex5 KO Sense A + PURO
• Genbank: ENSG00000153317
• Species: Human

Sequence of Insert

GTCCACACTGCTGAAAAATC

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU69614
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR nickase KO guide, use in conjunction with 69615.
• Low Temp: No