cDNA Clone ASAP1

• Synonyms: AMAP1, CENTB4, DDEF1, PAG2, PAP, ZG14P, KIAA1249
• Plasmid: pX335 ASAP1 ex5 KO Antisense A
• Parent Plasmid: pX335
• Expressed: ASAP1 ex5 KO Antisense A + Cas9n
• Genbank: ENSG00000153317
• Species: Human

Sequence of Insert

GACAAACGCGGTGCCAAGGT

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU69615
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR nickase KO guide, use in conjunction with 69614.
• Low Temp: No