cDNA Clone USP49

• Plasmid: pX335 USP49 Nter KI antisense
• Parent Plasmid: pX335
• Expressed: USP49 Nter KI sense guide
• Genbank: ENSG00000164663
• Species: Human

Sequence of Insert

GTGCCACCACCGAGTCCGTG

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU54127
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR Nter KI guide, use in conjunction with 54123 and a suitable donor.