cDNA Clone CD2AP

• Synonyms: CMS
• Plasmid: pBABED P U6 CD2AP KO sense
• Parent Plasmid: pBABED P U6
• Expressed: CD2AP KO sense guide
• Genbank: NM_012120.2
• Species: Human

Sequence of Insert

GTACAACGAATAAGCACCTA

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU52080
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR KO guide, use in conjunction with 52091