cDNA Clone WNK1

• Synonyms: HSAN2, HSN2, KDP, PPP1R167, PRKWNK1, PSK, p65
• Plasmid: pBABED P U6 WNK1 Ex5 KO sense
• Parent Plasmid: pBABED P U6
• Expressed: WNK1 Ex5 KO sense guide
• Genbank: NM_018979.3
• Species: Human

Sequence of Insert

GAAGTGAAGGAAATTATTGA

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48796
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR guide plasmid. Targets sense strand in first common coding exon (exon 5), designed to KO WNK1 when used in conjunction with antisense guide 48904 (D10A approach). Guide sequence shown as sequence of insert. Positives may be enriched for with puromycin prior to further selection using western blotting.