cDNA Clone WNK3

• Synonyms: PRKWNK3
• Plasmid: pBABED P U6 WNK3 D294A sense
• Parent Plasmid: pBABED P U6
• Expressed: WNK3 D294A sense guide
• Genbank: NM_020922.4
• Species: Human

Sequence of Insert

GTCATTTGCTAAGAGTGTCAT

• Vector Type: Other
• Antibiotic: Amp
• DU Number: DU48791
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR guide plasmid. Targets exon 4, designed to introduce a D294A point mutation when used in conjunction with antisense guide 48785 and a ssODN donor (D10A approach). Guide sequence shown as sequence of insert and donor as expression cassette. Positives may be enriched for with puromycin prior to further selection using western blotting with a phospho specific antibody or RFLP using the SfoI site introduced upon recombination.