cDNA Clone WNK2

• Synonyms: NY-CO-43, P/OKcl.13, PRKWNK2, SDCCAG43
• Plasmid: pBABED P WNK2 D342A sense
• Parent Plasmid: pBABED P U6
• Expressed: WNK2 D342A sense
• Genbank: NP_005100
• Species: Human

Sequence of Insert

GAAGATTGGCGACTTGGGCC

• Vector Type: Other
• Antibiotic: Amp
• DU Number: DU48775
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR guide plasmid. Targets sense strand in exon 3, designed to introduce a D342A point mutation when used in conjunction with antisense guide 48784 and a ssODN donor (D10A approach). Guide sequence shown as sequence of insert and donor shown as expression cassette. Positives may be enriched for with puromycin prior to further selection using western blotting with a phospho specific antibody or RFLP using the SfoI site introduced upon recombination.