cDNA Clone WNK2

• Synonyms: NY-CO-43, P/OKcl.13, PRKWNK2, SDCCAG43
• Plasmid: pX335 WNK2 KO ex1 antisense
• Parent Plasmid: pX335
• Expressed: WNK2 KO ex1 antisense
• Genbank: NP_005100
• Species: Human

Sequence of Insert

GCAGAAGCACCCGGCGCTGC

• Vector Type: Other
• Antibiotic: Amp
• DU Number: DU48771
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: CRISPR guide plasmid. Targets antisense strand in first common coding exon (exon 1), designed to KO WNK2 when used in conjunction with sense guide 48772. Guide sequence shown as sequence of insert. Positives may be enriched for with puromycin prior to further selection using western blotting.