cDNA Clone USP30

• Plasmid: pU6D USP30 BspHI KO guide
• Parent Plasmid: pU6D gRNA
• Expressed: USP30 BspHI KO guide
• Genbank: NM_032663.3
• Species: Human

Sequence of Insert

GATATAAAGTCATGAAGAAC(TGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48525
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses USP30 BspHI KO guide RNA, 20mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Target site situated on sense strand in the first common coding exon 2 and guide designed to KO BspHI by introducing an Indel via CRISPR. To be screened for by PCR and BspHI digestion, loss of the site shall indicate a deletion event and potential frameshift.