cDNA Clone UBE2S

• Synonyms: E2-EPF, E2EPF, EPF5
• Plasmid: pU6 TRIM49 Nter gRNA 2
• Parent Plasmid: pU6 gRNA
• Expressed: UBE2S Nter gRNA 2
• Genbank: ENSG00000108106
• Species: Human

Sequence of Insert

GGAACAGACCTCCAGCATAT(GGG)

• Vector Type: Mammalian
• Antibiotic: Amp
• DU Number: DU48401
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Expresses UBE2S guide RNA, 20mer target sequence shown as sequence of insert with remaining 3 bases of PAM site in brackets. Targets exon 3 on reverse strand and is designed to KO UBE2S by introducing an Indel via CRISPR. To be screened for by PCR and NdeI digestion, loss of the site shall indicate the presence of an Indel and possible KO.