cDNA Clone C. elegans SPT-2 HBD (551-666)

• Synonyms: T05A12.3
• Plasmid: His14-SUMO
• Expressed: His14-SUMO-C. elegans SPT-2 HBD (551-666)
• Genbank: NM_068658.6
• Antibiotic: Kan
• Full Snapgene Map: His14-SUMO43.84 KBSnapgene files can be opened using software available here: www.snapgene.com
• DU Number: DU70520
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: The plasmid was obtained by performing deletion mutagenesis of plasmid DU70516, via InFusion cloning using primers GSA40 and GSA41. ; GSA40 GGAAGTTTCTACAAAGGTGGTGATGATTAT; GSA41 TTTGTAGAAACTTCCGCCACCAATCTGTTC; Corresponds to #98 in GSaredi library.
• Low Temp: No