cDNA Clone Ufl1/DDRGK1

• Synonyms: cHMM132
• Plasmid: pETDuet1 6His Ufl1 1-116/StrepII DDRGK1 207-C
• Parent Plasmid: pETDuet1
• Expressed: 6His Ufl1 1-116/StrepII DDRGK1 207-C
• Genbank: NM_015323.4
• Tag: 6His
• Species: Human

Sequence of Insert

See snapgene file

Amino Acid Sequence

See snapgene file

• Vector Type: Bacterial
• Antibiotic: Amp
• Full Snapgene Map: pETDuet1 6His Ufl1 1-116/StrepII DDRGK1 207-C804.45 KBSnapgene files can be opened using software available here: www.snapgene.com
• DU Number: DU73845
• Unit Source: Protein Phosphorylation and Ubiquitylation Unit
• Location: PPU
• MTA: Dundee
• Notes: Mutagenesis of (cHMM106 DU73842) using oligos CATCACCATCACCATATGGCGGACGCCTGGGAAG, CCAGGCGTCCGCCATATGGTGATGGTGATGGTGTCCC, GGGACAACTGATAGATTAGAATTATTTGGATCGG; and CCGATCCAAATAATTCTAATCTATCAGTTGTCCC to remove the TEV cleavage site and to truncate Ufl1 after residue 116.; Made and deposited by Helge Magnussen (MRCPPU Kulathu group).
• Low Temp: No